Structure and Packing of Human Telomeric DNA. Determined by X-ray diffraction at 2.1 Å resolution. Released 31 May 2002.
Explore 1KF1 in 3D Show helices and sheets RCSB PDB PDBe
| Molecule | Chains | Type | Length | Organism | UniProt |
|---|---|---|---|---|---|
| 5'-d(*ap*gp*gp*gp*tp*tp*ap*gp*gp*gp*tp*tp*ap*gp*gp*gp*tp*tp*ap*gp*gp*g)-3 | A | DNA | 22 |
>1KF1_1 5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3 (chains A) AGGGTTAGGGTTAGGGTTAGGG
Crystal structure of parallel quadruplexes from human telomeric DNA. Parkinson, G.N., Lee, M.P., Neidle, S. Nature (2002) 417:876-880. DOI 10.1038/nature755 · PubMed
1KF1 is part of these collections:
MolViewer shows 1KF1 directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.