1Y26: A-riboswitch-adenine complex

A-riboswitch-adenine complex. Determined by X-ray diffraction at 2.1 Å resolution. Released 28 Dec 2004.

Method: X-ray diffraction
Resolution: 2.1 Å
Organism: Vibrio vulnificus
Chains: 1
Atoms: 1,608
Mol. weight: 22.95 kDa
Ligands: ADE, MG
Released: 28 Dec 2004

Explore 1Y26 in 3D Show helices and sheets RCSB PDB PDBe

Molecules and chains

Molecule	Chains	Type	Length	Organism	UniProt
Vibrio vulnificus A-riboswitch	X	RNA	71	Vibrio vulnificus

Sequence of entity 1 (X), FASTA

>1Y26_1 Vibrio vulnificus A-riboswitch (chains X)
CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUG
AUUAUGAAGUG

Ligands and cofactors

ID	Name	Formula	Copies
ADE	Adenine	C5 H5 N5	1
MG	Magnesium ion	Mg	5

Primary citation

Structural Basis for Discriminative Regulation of Gene Expression by Adenine- and Guanine-Sensing mRNAs. Serganov, A., Yuan, Y.R., Pikovskaya, O. et al. Chem Biol (2004) 11:1729-1741. DOI 10.1016/j.chembiol.2004.11.018 · PubMed

Browse more

1Y26 is part of these collections:

DNA and RNA

About this viewer

MolViewer shows 1Y26 directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.