1EHZ: Yeast phenylalanine tRNA

The crystal structure of yeast phenylalanine tRNA at 1.93 A resolution. Determined by X-ray diffraction at 1.93 Å resolution. Released 2 Oct 2000.

Method: X-ray diffraction
Resolution: 1.93 Å
Organism: Saccharomyces cerevisiae
Chains: 1
Atoms: 1,821
Mol. weight: 25.2 kDa
Ligands: MG, MN
Released: 2 Oct 2000

Explore 1EHZ in 3D Show helices and sheets RCSB PDB PDBe

Molecules and chains

Molecule	Chains	Type	Length	Organism	UniProt
Transfer RNA (PHE)	A	RNA	76	Saccharomyces cerevisiae

Sequence of entity 1 (A), FASTA

>1EHZ_1 TRANSFER RNA (PHE) (chains A)
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUC
CACAGAAUUCGCACCA

Ligands and cofactors

ID	Name	Formula	Copies
MG	Magnesium ion	Mg	6
MN	Manganese (II) ion	Mn	3

Primary citation

The crystal structure of yeast phenylalanine tRNA at 1.93 A resolution: a classic structure revisited. Shi, H., Moore, P.B. RNA (2000) 6:1091-1105. DOI 10.1017/S1355838200000364 · PubMed

Browse more

1EHZ is part of these collections:

About this viewer

MolViewer shows 1EHZ directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.