1FOS: Two human C-fos:c-jun:dna complexes

Two human C-fos:c-jun:dna complexes. Determined by X-ray diffraction at 3.05 Å resolution. Released 10 Jul 1995.

Method: X-ray diffraction
Resolution: 3.05 Å
Organism: Homo sapiens
Chains: 8
Atoms: 3,480
Mol. weight: 53.93 kDa
Released: 10 Jul 1995

Explore 1FOS in 3D Show helices and sheets RCSB PDB PDBe

Secondary structure: helices and β-sheets

1FOS contains 4 α-helices and 0 β-strands across 4 chains. Residue ranges use author residue numbering, as in the PDB file, from PDBe. To see them in 3D, choose the Cartoon representation with Secondary structure coloring: helices, sheets and coils get different colors.

Chain E: 1 helix, 0 β-strands

Element	Residues	Length	Sheet
α-helix	140-196	57

Chains F and H: 1 helix, 0 β-strands

Element	Residues	Length	Sheet
α-helix	267-321	55

Chain G: 1 helix, 0 β-strands

Element	Residues	Length	Sheet
α-helix	141-197	57

Molecules and chains

Molecule	Chains	Type	Length	Organism	UniProt
DNA (5'-d(apaptpgpgpaptpgpapgptpcpaptpapgpgpapgpa)-3')	A, C	DNA	20
DNA (5'-d(tptpcptpcpcptpaptpgpapcptpcpaptpcpcpapt)-3')	B, D	DNA	20
P55-C-fos proto-oncogene protein	E, G	protein	62	Homo sapiens	P01100 (AlphaFold model)
C-jun proto-oncogene protein	F, H	protein	62	Homo sapiens	P05412 (AlphaFold model)

Sequence of entity 1 (A, C), FASTA

>1FOS_1 DNA (5'-D(*AP*AP*TP*GP*GP*AP*TP*GP*AP*GP*TP*CP*AP*TP*AP*GP*GP*AP*GP*A)-3') (chains A, C)
AATGGATGAGTCATAGGAGA

Sequence of entity 2 (B, D), FASTA

>1FOS_2 DNA (5'-D(*TP*TP*CP*TP*CP*CP*TP*AP*TP*GP*AP*CP*TP*CP*AP*TP*CP*CP*AP*T)-3') (chains B, D)
TTCTCCTATGACTCATCCAT

Sequence of entity 3 (E, G), FASTA

>1FOS_3 P55-C-FOS PROTO-ONCOGENE PROTEIN (chains E, G)
KRRIRRERNKMAAAKSRNRRRELTDTLQAETDQLEDEKSALQTEIANLLKEKEKLEFILA
AH

Sequence of entity 4 (F, H), FASTA

>1FOS_4 C-JUN PROTO-ONCOGENE PROTEIN (chains F, H)
KAERKRMRNRIAASKSRKRKLERIARLEEKVKTLKAQNSELASTANMLREQVAQLKQKVM
NH

Primary citation

Crystal structure of the heterodimeric bZIP transcription factor c-Fos-c-Jun bound to DNA. Glover, J.N., Harrison, S.C. Nature (1995) 373:257-261. DOI 10.1038/373257a0 · PubMed

Other PDB entries of the same protein (UniProt P01100 (AlphaFold model), which also has an AlphaFold model), best resolution first:

1A02 2.7 Å, Structure of the DNA binding domains of nfat, fos and jun bound to DNA
1S9K 3.1 Å, Crystal Structure of Human NFAT1 and Fos-Jun on the IL-2 ARRE1 Site

Browse structure collections

About this viewer

MolViewer shows 1FOS directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.