4TNA: Trnaphe

Name: PDB 4TNA: Further refinement of the structure of yeast T-RNA-phe
Published: 1978-04-12
License: https://creativecommons.org/publicdomain/zero/1.0/
Keywords: t-rna

Further refinement of the structure of yeast T-RNA-phe. Determined by X-ray diffraction at 2.5 Å resolution. Released 12 Apr 1978.

Method: X-ray diffraction
Resolution: 2.5 Å
Organism: Saccharomyces cerevisiae
Chains: 1
Atoms: 1,656
Mol. weight: 24.99 kDa
Ligands: MG
Released: 12 Apr 1978

Explore 4TNA in 3D Show helices and sheets RCSB PDB PDBe

Molecules and chains

Molecule	Chains	Type	Length	Organism	UniProt
Trnaphe	A	RNA	76	Saccharomyces cerevisiae

Sequence of entity 1 (A), FASTA

>4TNA_1 TRNAPHE (chains A)
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUC
CACAGAAUUCGCACCA

Ligands and cofactors

ID	Name	Formula	Copies
MG	Magnesium ion	Mg	4

Primary citation

Further refinement of the structure of yeast tRNAPhe. Hingerty, B., Brown, R.S., Jack, A. J Mol Biol (1978) 124:523-534. DOI 10.1016/0022-2836(78)90185-7 · PubMed

Browse more

4TNA is part of these collections:

The ribosome and protein synthesis

About this viewer

MolViewer shows 4TNA directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.