1JNM: Jun/CRE Complex

Crystal Structure of the Jun/CRE Complex. Determined by X-ray diffraction at 2.2 Å resolution. Released 3 Jun 2003.

Method: X-ray diffraction
Resolution: 2.2 Å
Organism: Homo sapiens
Chains: 4
Atoms: 1,957
Mol. weight: 26.91 kDa
Released: 3 Jun 2003

Explore 1JNM in 3D Show helices and sheets RCSB PDB PDBe

Secondary structure: helices and β-sheets

1JNM contains 2 α-helices and 0 β-strands across 2 chains. Residue ranges use author residue numbering, as in the PDB file, from PDBe. To see them in 3D, choose the Cartoon representation with Secondary structure coloring: helices, sheets and coils get different colors.

Chain A: 1 helix, 0 β-strands

Element	Residues	Length	Sheet
α-helix	255-306	52

Chain B: 1 helix, 0 β-strands

Element	Residues	Length	Sheet
α-helix	255-307	53

Molecules and chains

Molecule	Chains	Type	Length	Organism	UniProt
5'-d(cpgptpcpgpaptpgpapcpgptpcpaptpcpgpapcpg)-3'	C, D	DNA	20
Proto-oncogene C-jun	A, B	protein	62	Homo sapiens	P05412 (AlphaFold model)

Sequence of entity 1 (C, D), FASTA

>1JNM_1 5'-D(*CP*GP*TP*CP*GP*AP*TP*GP*AP*CP*GP*TP*CP*AP*TP*CP*GP*AP*CP*G)-3' (chains C, D)
CGTCGATGACGTCATCGACG

Sequence of entity 2 (A, B), FASTA

>1JNM_2 PROTO-ONCOGENE C-JUN (chains A, B)
KAERKRMRNRIAASKSRKRKLERIARLEEKVKTLKAQNSELASTANMLREQVAQLKQKVM
NH

Primary citation

Crystal Structure of the Jun bZIP homodimer complexed with CRE. Kim, Y., Podust, L.M. To be published.

Other PDB entries of the same protein (UniProt P05412 (AlphaFold model), which also has an AlphaFold model), best resolution first:

6Y3V 1.5 Å, 14-3-3 Sigma in complex with phosphorylated c-Jun peptide
5T01 1.89 Å, Human c-Jun DNA binding domain homodimer in complex with methylated DNA
5FV8 1.99 Å, Structure of cJun-FosW coiled coil complex.
8SOS 2.33 Å, Human CD1d presenting sphingomyelin C24:1 in complex with VHH nanobody 1D17
1A02 2.7 Å, Structure of the DNA binding domains of nfat, fos and jun bound to DNA
1T2K 3.0 Å, Structure Of The DNA Binding Domains Of IRF3, ATF-2 and Jun Bound To DNA
1FOS 3.05 Å, Two human C-fos:c-jun:dna complexes
1S9K 3.1 Å, Crystal Structure of Human NFAT1 and Fos-Jun on the IL-2 ARRE1 Site
1JUN NMR study of C-jun homodimer

Browse structure collections

About this viewer

MolViewer shows 1JNM directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.