1QA6: Conserved ribosomal protein-RNA complex

Crystal structure of a conserved ribosomal protein-RNA complex. Determined by X-ray diffraction at 2.8 Å resolution. Released 25 May 1999.

Method: X-ray diffraction
Resolution: 2.8 Å
Organism: Geobacillus stearothermophilus
Chains: 4
Atoms: 3,482
Mol. weight: 52.54 kDa
Ligands: OS, MG
Released: 25 May 1999

Explore 1QA6 in 3D Show helices and sheets RCSB PDB PDBe

Secondary structure: helices and β-sheets

1QA6 contains 10 α-helices and 0 β-strands across 2 chains. Residue ranges use author residue numbering, as in the PDB file, from PDBe. To see them in 3D, choose the Cartoon representation with Secondary structure coloring: helices, sheets and coils get different colors.

Chains A and B: 5 helices, 0 β-strands

Element	Residues	Length
α-helix	10-18	9
α-helix	36-40	5
α-helix	41-47	7
α-helix	48-50	3
α-helix	56-70	15

Molecules and chains

Molecule	Chains	Type	Length	Organism	UniProt
58 nucleotide ribosomal RNA domain	C, D	RNA	58
Ribosomal protein L11	A, B	protein	67	Geobacillus stearothermophilus	P56210 (AlphaFold model)

Sequence of entity 1 (C, D), FASTA

>1QA6_1 58 NUCLEOTIDE RIBOSOMAL RNA DOMAIN (chains C, D)
GCCAGGAUGUAGGCUUAGAAGCAGCCAUCAUUUAAAGAAAGCGUAAUAGCUCACUGGU

Sequence of entity 2 (A, B), FASTA

>1QA6_2 RIBOSOMAL PROTEIN L11 (chains A, B)
KTPPAAVLLKKAAGIESGSGEPNRNKVATIKRDKVREIAELKMPDLNAASIEAAMRMIEG
TARSMGI

Ligands and cofactors

ID	Name	Formula	Copies
OS	Osmium ion	Os	4
MG	Magnesium ion	Mg	4

Primary citation

Crystal structure of a conserved ribosomal protein-RNA complex. Conn, G.L., Draper, D.E., Lattman, E.E. et al. Science (1999) 284:1171-1174. DOI 10.1126/science.284.5417.1171 · PubMed

Other PDB entries of the same protein (UniProt P56210 (AlphaFold model), which also has an AlphaFold model), best resolution first:

1HC8 2.8 Å, Crystal structure of a conserved ribosomal protein-RNA complex
1Y39 2.8 Å, Co-evolution of protein and RNA structures within a highly conserved ribosomal domain
1C04 5.0 Å, Identification of known protein and RNA structures in a 5 a map of the large ribosomal…
1ACI L11 ribosomal protein RNA binding domain, NMR, 20 structures
1FOW NMR structure of L11-C76, the C-terminal domain of 50S ribosomal protein L11, minimized…
1FOX NMR structure of L11-C76, the C-terminal domain of 50S ribosomal protein L11, 33…
1FOY The RNA binding domain of ribosomal protein L11: three-dimensional structure of the…
2FOW The RNA binding domain of ribosomal protein L11: three-dimensional structure of the…

Browse structure collections

About this viewer

MolViewer shows 1QA6 directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.