6MCE: HIV-1 TAR with Tat RNA Binding Domain

Solution structure of HIV-1 TAR with Tat RNA Binding Domain. Determined by solution NMR. Released 31 Oct 2018.

Method

Solution NMR

Organisms

Human immunodeficiency virus 1, Human immunodeficiency virus type 1 group M subtype B

Chains

2

Atoms

790

Mol. weight

11.82 kDa

Released

31 Oct 2018

Explore 6MCE in 3D Show helices and sheets RCSB PDB PDBe

Molecules and chains

>6MCE_1 TAR RNA (chains A)
GGGCAGAUUGAGCCUGGGAGCUCUCUGCCC

>6MCE_2 Protein Tat (chains B)
GISYGRKKRRQRRRAHQ

Primary citation

HIV-1 Tat interactions with cellular 7SK and viral TAR RNAs identifies dual structural mimicry. Pham, V.V., Salguero, C., Khan, S.N. et al. Nat Commun (2018) 9:4266-4266. DOI 10.1038/s41467-018-06591-6 · PubMed

Related structures

Other PDB entries of the same protein (UniProt P04608 (AlphaFold model), which also has an AlphaFold model), best resolution first:

• 3MI9 2.1 Å, Crystal structure of HIV-1 Tat complexed with human P-TEFb
• 5V61 2.2 Å, Phospho-ERK2 bound to bivalent inhibitor SBP2
• 4OR5 2.9 Å, Crystal structure of HIV-1 Tat complexed with human P-TEFb and AFF4
• 3MIA 3.0 Å, Crystal structure of HIV-1 Tat complexed with ATP-bound human P-TEFb
• 6CYT 3.5 Å, HIV-1 TAR loop in complex with Tat:AFF4:P-TEFb
• 6MCF Solution structure of 7SK stem-loop 1 with HIV-1 Tat RNA Binding Domain

Browse structure collections

About this viewer

MolViewer shows 6MCE directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.