6MCF: Protein Tat

Solution structure of 7SK stem-loop 1 with HIV-1 Tat RNA Binding Domain. Determined by solution NMR. Released 31 Oct 2018.

Method: Solution NMR
Organisms: Homo sapiens, Human immunodeficiency virus type 1 group M subtype B
Chains: 2
Atoms: 1,365
Mol. weight: 20.52 kDa
Released: 31 Oct 2018

Explore 6MCF in 3D Show helices and sheets RCSB PDB PDBe

Secondary structure: helices and β-sheets

6MCF contains 0 α-helices and 2 β-strands across 1 chain. Residue ranges use author residue numbering, as in the PDB file, from PDBe. To see them in 3D, choose the Cartoon representation with Secondary structure coloring: helices, sheets and coils get different colors.

Chain B: 0 helices, 2 β-strands

Element	Residues	Length	Sheet
β-strand	51	1	1
β-strand	55	1	1

Molecules and chains

Molecule	Chains	Type	Length	Organism	UniProt
7SK Stem-loop 1 RNA	A	RNA	57	Homo sapiens
Protein Tat	B	protein	17	Human immunodeficiency virus type 1 group M subtype B	P04608 (AlphaFold model)

Sequence of entity 1 (A), FASTA

>6MCF_1 7SK Stem-loop 1 RNA (chains A)
GGGAUCUGUCACCCCAUUGAUCGCCGAGAGGCUGAUCUGGXUGGXUAGGCGGGUCCC

Sequence of entity 2 (B), FASTA

>6MCF_2 Protein Tat (chains B)
GISYGRKKRRQRRRAHQ

Primary citation

HIV-1 Tat interactions with cellular 7SK and viral TAR RNAs identifies dual structural mimicry. Pham, V.V., Salguero, C., Khan, S.N. et al. Nat Commun (2018) 9:4266-4266. DOI 10.1038/s41467-018-06591-6 · PubMed

Other PDB entries of the same protein (UniProt P04608 (AlphaFold model), which also has an AlphaFold model), best resolution first:

3MI9 2.1 Å, Crystal structure of HIV-1 Tat complexed with human P-TEFb
5V61 2.2 Å, Phospho-ERK2 bound to bivalent inhibitor SBP2
4OR5 2.9 Å, Crystal structure of HIV-1 Tat complexed with human P-TEFb and AFF4
3MIA 3.0 Å, Crystal structure of HIV-1 Tat complexed with ATP-bound human P-TEFb
6CYT 3.5 Å, HIV-1 TAR loop in complex with Tat:AFF4:P-TEFb
6MCE Solution structure of HIV-1 TAR with Tat RNA Binding Domain

Browse structure collections

About this viewer

MolViewer shows 6MCF directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.