The N-terminal region of Cdc6 specifically recognizes human DNA G-quadruplex. Determined by solution NMR. Released 27 Dec 2023.
Explore 8HT7 in 3D Show helices and sheets RCSB PDB PDBe
| Molecule | Chains | Type | Length | Organism | UniProt |
|---|---|---|---|---|---|
| DNA (5'-d(*gp*gp*gp*tp*tp*ap*gp*gp*gp*tp*tp*ap*gp*gp*gp*tp*tp*tp*gp*gp*g)-3') | A | DNA | 21 | Homo sapiens | |
| Gln-ala-gln-ala-thr-ile-ser-phe-pro-lys-arg-lys-leu-ser-trp | B | protein | 15 | Homo sapiens | Q99741 (AlphaFold model) |
>8HT7_1 DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') (chains A) GGGTTAGGGTTAGGGTTTGGG
>8HT7_2 GLN-ALA-GLN-ALA-THR-ILE-SER-PHE-PRO-LYS-ARG-LYS-LEU-SER-TRP (chains B) QAQATISFPKRKLSW
The N-terminal region of Cdc6 specifically recognizes human DNA G-quadruplex. Geng, Y., Liu, C., Xu, N. et al. Int J Biol Macromol (2024) 260:129487-129487. DOI 10.1016/j.ijbiomac.2024.129487 · PubMed
Other PDB entries of the same protein (UniProt Q99741 (AlphaFold model), which also has an AlphaFold model), best resolution first:
MolViewer shows 8HT7 directly in your browser with nothing to install. Switch between cartoon, ball-and-stick, spacefill and surface views, color by chain, secondary structure or B-factor, measure distances, angles and dihedrals, and share or embed the view.